Stem-loop sequence sja-mir-307

AccessionMI0015297 (change log)
DescriptionSchistosoma japonicum miR-307 stem-loop
Literature search

1 open access papers mention sja-mir-307
(6 sentences)

Stem-loop
   a   --a       -ua   a       uu      ---------       auaauuaauaauaauuauuauuauuauuau 
5'  gaa   cuccuca   aag agguugu  gaugua         auauuca                              u
    |||   |||||||   ||| |||||||  ||||||         |||||||                              a
3'  cuu   ggggagu   uuc uccaaca  cuacau         uauaagu                              u
   g   cac       uag   a       --      ucaauaaaa       agaagaaauauaauaauaaaguagcuuuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01062455.1: 2211-2363 [+]
intergenic
Database links

Mature sequence sja-miR-307

Accession MIMAT0016270
Sequence

124 - 

ucacaaccuacuugauugag

 - 143

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).