![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sja-mir-2c |
||||||||
Accession | MI0015301 (change log) | |||||||
Description | Schistosoma japonicum miR-2c stem-loop | |||||||
Gene family | MIPF0000049; mir-2 | |||||||
Literature search |
![]()
7 open access papers mention sja-mir-2c | |||||||
Stem-loop |
- a caa --uu a auuga 5' uuc ggcg cccuug cg cugugaugug a ||| |||| |||||| || |||||||||| a 3' aag cugc gggaau gc gacacuauac u a - uuc ucgu c ccgau |
|||||||
Confidence |
Annotation confidence: not enough data
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence sja-miR-2c-5p |
|
Accession | MIMAT0016276 |
Sequence |
11 - acccuuguucgacugugaugug - 32 |
Evidence | experimental; Illumina [1] |
Mature sequence sja-miR-2c-3p |
|
Accession | MIMAT0016277 |
Sequence |
48 - uaucacagccgugcuuaagggc - 69 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:20161724
"An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum"
PLoS Negl Trop Dis. 4:e596(2010).
|