Stem-loop sequence sja-mir-2e

AccessionMI0015310 (change log)
DescriptionSchistosoma japonicum miR-2e stem-loop
Gene family MIPF0000049; mir-2
Literature search

7 open access papers mention sja-mir-2e
(31 sentences)

Stem-loop
   ccaccgcu        --   a     a u     --u   ac 
5'         cuuaccaa  cuu gacug g uauac   gcu  u
           ||||||||  ||| ||||| | |||||   |||   
3'         gaaugguu  gaa cugac c auaug   cga  g
   -uaguuuu        uc   c     a u     uuu   au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01007682.1: 2769-2851 [-]
intergenic
Clustered miRNAs
< 10kb from sja-mir-2e
sja-mir-71aCABF01007682.1: 3056-3135 [-]
sja-mir-2aCABF01007682.1: 2964-3041 [-]
sja-mir-2bCABF01007682.1: 2869-2946 [-]
sja-mir-2eCABF01007682.1: 2769-2851 [-]
Database links

Mature sequence sja-miR-2e-5p

Accession MIMAT0016294
Sequence

11 - 

uaccaacuuagacugaguuau

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sja-miR-2e-3p

Accession MIMAT0016295
Sequence

53 - 

uaucacaguccaagcuuuggu

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).