Stem-loop sequence sja-mir-2e

Accession

MI0015310 (change log)

Description

Schistosoma japonicum miR-2e stem-loop

Gene family

MIPF0000049; mir-2

Literature search

7 open access papers mention sja-mir-2e
(31 sentences)

Stem-loop

   ccaccgcu        --   a     a u     --u   ac 
5'         cuuaccaa  cuu gacug g uauac   gcu  u
           ||||||||  ||| ||||| | |||||   |||   
3'         gaaugguu  gaa cugac c auaug   cga  g
   -uaguuuu        uc   c     a u     uuu   au 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (ASM15177v1; GCA_000151775.1): CABF01007682.1: 2769-2851 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from sja-mir-2e

• sja-mir-71a: CABF01007682.1: 3056-3135 [-]
• sja-mir-2a: CABF01007682.1: 2964-3041 [-]
• sja-mir-2b: CABF01007682.1: 2869-2946 [-]
• sja-mir-2e: CABF01007682.1: 2769-2851 [-]

Database links

• miRBase Tracker:MI0015310

Mature sequence sja-miR-2e-5p

• Accession: MIMAT0016294
• Sequence: 11 - uaccaacuuagacugaguuau - 31
• Evidence: experimental; Illumina [1]

Mature sequence sja-miR-2e-3p

• Accession: MIMAT0016295
• Sequence: 53 - uaucacaguccaagcuuuggu - 73
• Evidence: experimental; Illumina [1]

References

1. PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).