![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sja-mir-2e |
||||||||||
Accession | MI0015310 (change log) | |||||||||
Description | Schistosoma japonicum miR-2e stem-loop | |||||||||
Gene family | MIPF0000049; mir-2 | |||||||||
Literature search |
![]()
7 open access papers mention sja-mir-2e | |||||||||
Stem-loop |
ccaccgcu -- a a u --u ac 5' cuuaccaa cuu gacug g uauac gcu u |||||||| ||| ||||| | ||||| ||| 3' gaaugguu gaa cugac c auaug cga g -uaguuuu uc c a u uuu au |
|||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
|
Mature sequence sja-miR-2e-5p |
|
Accession | MIMAT0016294 |
Sequence |
11 - uaccaacuuagacugaguuau - 31 |
Evidence | experimental; Illumina [1] |
Mature sequence sja-miR-2e-3p |
|
Accession | MIMAT0016295 |
Sequence |
53 - uaucacaguccaagcuuuggu - 73 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:20161724
"An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum"
PLoS Negl Trop Dis. 4:e596(2010).
|