Stem-loop sequence ahy-MIR156a

AccessionMI0015332 (change log)
DescriptionArachis hypogaea miR156a stem-loop
Gene family MIPF0000008; MIR156
Literature search

5 open access papers mention ahy-MIR156a
(42 sentences)

Stem-loop
   ga      uauaa   u           -          -a     g   u   c      
5'   agagau     aug ugacagaagag agagagcaca  cccga aaa ggu aaaga 
     ||||||     ||| ||||||||||| ||||||||||  ||||| ||| ||| |||| a
3'   uuucua     uac acugucuucuc ucucucgugu  ggguu uuu cca uuucu 
   -a      -uuuc   u           a          ga     g   -   u      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ahy-miR156a

Accession MIMAT0016317
Sequence

18 - 

ugacagaagagagagagcac

 - 37

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20047695 "Deep sequencing identifies novel and conserved microRNAs in peanuts (Arachis hypogaea L.)" Zhao CZ, Xia H, Frazier TP, Yao YY, Bi YP, Li AQ, Li MJ, Li CS, Zhang BH, Wang XJ BMC Plant Biol. 10:3(2010).