Stem-loop sequence ahy-MIR156b

AccessionMI0015333 (change log)
DescriptionArachis hypogaea miR156b stem-loop
Gene family MIPF0000008; MIR156
Literature search

5 open access papers mention ahy-MIR156b
(39 sentences)

Stem-loop
   -------      acuau   u     u u         -a             -a     u     ---    ga 
5'        ggaggc     ugg agagu g ugacagaag  uagagagcacaaa  gauga augca   uaua  u
          ||||||     ||| ||||| | |||||||||  |||||||||||||  ||||| |||||   ||||   
3'        ucuccg     acu ucuca c acugucuuc  aucucucguguuu  uuauu uacgu   auau  a
   aucuuua      -----   -     - u         ga             cc     u     cug    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ahy-miR156b-5p

Accession MIMAT0016318
Sequence

23 - 

uugacagaagauagagagcac

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ahy-miR156b-3p

Accession MIMAT0016319
Sequence

94 - 

gcucucuaagcuucugucauc

 - 114

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20047695 "Deep sequencing identifies novel and conserved microRNAs in peanuts (Arachis hypogaea L.)" Zhao CZ, Xia H, Frazier TP, Yao YY, Bi YP, Li AQ, Li MJ, Li CS, Zhang BH, Wang XJ BMC Plant Biol. 10:3(2010).