Stem-loop sequence ahy-MIR156c

AccessionMI0015334 (change log)
DescriptionArachis hypogaea miR156c stem-loop
Gene family MIPF0000008; MIR156
Literature search

5 open access papers mention ahy-MIR156c
(38 sentences)

Stem-loop
   ----------  --u    --     uauaa   u           -          -a     g   u   c      
5'           cc   cgaa  gagau     aug ugacagaagag agagagcaca  cccga aaa ggu aaaga 
             ||   ||||  |||||     ||| ||||||||||| ||||||||||  ||||| ||| ||| |||| a
3'           gg   guuu  uucua     uac acugucuucuc ucucucgugu  ggguu uuu cca uuucu 
   uucuagauau  uau    au     -uuuc   u           a          ga     g   -   u      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ahy-miR156c

Accession MIMAT0016320
Sequence

21 - 

uugacagaagagagagagcac

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20047695 "Deep sequencing identifies novel and conserved microRNAs in peanuts (Arachis hypogaea L.)" Zhao CZ, Xia H, Frazier TP, Yao YY, Bi YP, Li AQ, Li MJ, Li CS, Zhang BH, Wang XJ BMC Plant Biol. 10:3(2010).