Stem-loop sequence ahy-MIR159

AccessionMI0015335 (change log)
DescriptionArachis hypogaea miR159 stem-loop
Gene family MIPF0000010; MIR159
Literature search

4 open access papers mention ahy-MIR159
(9 sentences)

Stem-loop
   ------------------a            ga       ca        -   -u      auu     g   a c      uc  a   u      - -a    uac 
5'                    guggagcuccuu  aguccaa  gagggucu ugg  ggguag   gagcu cua g uaugga  cc cag acuacc c  uaua   c
                      ||||||||||||  |||||||  |||||||| |||  ||||||   ||||| ||| | ||||||  || ||| |||||| |  ||||    
3'                    caucucgaggga  uuagguu  uuccuaga acc  uccauu   uucga ggu c auaccu  gg guc ugaugg g  guau   c
   uaaucuuucuccuacgaua            ag       ua        c   uu      -ac     g   c u      ua  c   u      u ac    uac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ahy-miR159

Accession MIMAT0016321
Sequence

157 - 

uuuggauugaagggagcucua

 - 177

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20047695 "Deep sequencing identifies novel and conserved microRNAs in peanuts (Arachis hypogaea L.)" Zhao CZ, Xia H, Frazier TP, Yao YY, Bi YP, Li AQ, Li MJ, Li CS, Zhang BH, Wang XJ BMC Plant Biol. 10:3(2010).