Stem-loop sequence ahy-MIR167

AccessionMI0015337 (change log)
DescriptionArachis hypogaea miR167 stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

4 open access papers mention ahy-MIR167
(20 sentences)

Stem-loop
   ga      -a   - u  a  u           g        uaac    -    uc uau 
5'   ucaugc  cca c ac ag ugaagcugcca caugaucu    uuuc ccuc  c   g
     ||||||  ||| | || || ||||||||||| ||||||||    |||| ||||  |    
3'   aguacg  ggu g ug uc acuuugacggu guacuaga    agag gggg  g   a
   ua      aa   u u  a  c           -        --cu    u    uu uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ahy-miR167-5p

Accession MIMAT0016324
Sequence

21 - 

ugaagcugccagcaugaucuu

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ahy-miR167-3p

Accession MIMAT0016325
Sequence

78 - 

agaucauguggcaguuucacc

 - 98

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20047695 "Deep sequencing identifies novel and conserved microRNAs in peanuts (Arachis hypogaea L.)" Zhao CZ, Xia H, Frazier TP, Yao YY, Bi YP, Li AQ, Li MJ, Li CS, Zhang BH, Wang XJ BMC Plant Biol. 10:3(2010).