Stem-loop sequence ahy-MIR394

AccessionMI0015338 (change log)
DescriptionArachis hypogaea miR394 stem-loop
Gene family MIPF0000100; MIR394
Literature search

2 open access papers mention ahy-MIR394
(2 sentences)

Stem-loop
   ag    u    -  u    au      auu   u        -  uc    
5'   gcau guuc ca agcc  uuuggc   cug ccaccucc ga  cga 
     |||| |||| || ||||  ||||||   ||| |||||||| ||  || u
3'   ugua uaag gu uugg  aaaccg   gac gguggagg cu  gcc 
   --    -    u  c    gc      gau   c        g  ua    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ahy-miR394

Accession MIMAT0016326
Sequence

22 - 

uuggcauucuguccaccucc

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20047695 "Deep sequencing identifies novel and conserved microRNAs in peanuts (Arachis hypogaea L.)" Zhao CZ, Xia H, Frazier TP, Yao YY, Bi YP, Li AQ, Li MJ, Li CS, Zhang BH, Wang XJ BMC Plant Biol. 10:3(2010).