Stem-loop sequence vvi-MIR2111

AccessionMI0015370 (change log)
DescriptionVitis vinifera miR2111 stem-loop
Gene family MIPF0000754; MIR2111
Literature search

2 open access papers mention vvi-MIR2111
(3 sentences)

Stem-loop
   gcaa      --  c    uc            u  u    u    auaa   uau 
5'     uauugg  gu agga  ggguaaucugca cc gagg cuag    gua   c
       ||||||  || ||||  |||||||||||| || |||| ||||    |||   u
3'     guaacc  ca uccu  uucauuagacgu gg cucc gauc    cgu   c
   ---c      gu  c    uc            u  u    u    --ga   ugc 
Get sequence
Deep sequencing
1381 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr8: 15368653-15368760 [-]
intergenic
Database links

Mature sequence vvi-miR2111-5p

Accession MIMAT0016364
Previous IDsvvi-miR2111
Sequence

23 - 

uaaucugcauccugaggucua

 - 43

Get sequence
Deep sequencing1347 reads, 2 experiments
Evidence by similarity; MI0010630

Mature sequence vvi-miR2111-3p

Accession MIMAT0016365
Previous IDsvvi-miR2111*
Sequence

69 - 

guccucugguugcagauuacu

 - 89

Get sequence
Deep sequencing34 reads, 2 experiments
Evidence by similarity; MI0010630

References

1
PMID:19854858 "Uncovering small RNA-mediated responses to phosphate deficiency in Arabidopsis by deep sequencing" Hsieh LC, Lin SI, Shih AC, Chen JW, Lin WY, Tseng CY, Li WH, Chiou TJ Plant Physiol. 151:2120-2132(2009).