Stem-loop sequence lja-MIR2111

AccessionMI0015371 (change log)
DescriptionLotus japonicus miR2111 stem-loop
Gene family MIPF0000754; MIR2111
Stem-loop
         cuac       ag   -g   a   -------      uca                   u   -aa      g 
5' ucaaac    uuggaug  uca  uau ggu       uuagga   gguaaucugcauccugagg uua   acaaua g
   ||||||    |||||||  |||  ||| |||       ||||||   ||||||||||||||||||| |||   ||||||  
3' aguuug    aauuuac  ggu  aua cca       aauccu   ccauuagacguaggauucc gau   uguuau u
         acua       ga   ag   a   cuauugu      ucg                   u   cug      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (lj2.5) Overlapping transcripts
Chr1: 42456511-42456663 [+]
intergenic
Clustered miRNAs
< 10kb from lja-MIR2111
lja-MIR7537Chr1: 42455050-42455260 [+]
lja-MIR2111Chr1: 42456511-42456663 [+]
Database links

Mature sequence lja-miR2111-5p

Accession MIMAT0016366
Previous IDslja-miR2111
Sequence

42 - 

uaaucugcauccugagguuua

 - 62

Get sequence
Evidence by similarity; MI0010630

Mature sequence lja-miR2111-3p

Accession MIMAT0016367
Previous IDslja-miR2111*
Sequence

86 - 

guccuuaggaugcagauuacc

 - 106

Get sequence
Evidence by similarity; MI0010630

References

1
PMID:19854858 "Uncovering small RNA-mediated responses to phosphate deficiency in Arabidopsis by deep sequencing" Hsieh LC, Lin SI, Shih AC, Chen JW, Lin WY, Tseng CY, Li WH, Chiou TJ Plant Physiol. 151:2120-2132(2009).