Stem-loop sequence rno-mir-3556b-1

AccessionMI0015414 (change log)
Previous IDsrno-mir-3556b
DescriptionRattus norvegicus miR-3556b-1 stem-loop
Gene family MIPF0001124; mir-3556
Stem-loop
         g u    cccc     --caua         aaa     -c    caaa 
5' gcuggu c uuuc    uacau      accgauuuc   uggug  uaga    a
   |||||| | ||||    |||||      |||||||||   |||||  ||||    a
3' ugacca g agag    augug      uggcuaaag   accac  gucu    c
         g u    ---a     uccgac         agg     aa    caga 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 38238896-38239002 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-3556b-1
rno-mir-29c-1chr1: 38238904-38238991 [+]
rno-mir-3556b-1chr1: 38238896-38239002 [-]
rno-mir-29b-2chr1: 38238376-38238456 [+]
Database links

Mature sequence rno-miR-3556b

Accession MIMAT0017818
Sequence

27 - 

accgauuucaaauggugcua

 - 46

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).