Stem-loop sequence rno-mir-3574

AccessionMI0015446 (change log)
DescriptionRattus norvegicus miR-3574 stem-loop
Literature search

1 open access papers mention rno-mir-3574
(2 sentences)

Stem-loop
   -   a     ucg g  gc     ga   au           a   -     g  g  ccg 
5'  gcc ggggu   c cu  ccagg  cag  cagccgcuguc cac gcaca ug gu   g
    ||| |||||   | ||  |||||  |||  ||||||||||| ||| ||||| || ||    
3'  ugg ccccg   g ga  ggucc  guc  gucggugacgg gug cgugu ac ca   a
   g   -     uca g  --     ga   cu           -   u     g  g  acg 
Get sequence
Deep sequencing
13 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 214208349-214208466 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-3574
rno-mir-3574chr1: 214208349-214208466 [+]
rno-mir-210chr1: 214208355-214208464 [-]
Database links

Mature sequence rno-miR-3574

Accession MIMAT0017860
Sequence

30 - 

ucagccgcugucacacgcacag

 - 51

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).