Stem-loop sequence rno-mir-3582

Accession MI0015456
Description Rattus norvegicus miR-3582 stem-loop
Gene family MIPF0000029; mir-133
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-133_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice. Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-  ug  uguccu      auca    aua    c       u   g           - auu 
 gc  gc      guggca    augc   gcua agcuggu gaa gggaccaaauc c   g
 ||  ||      ||||||    ||||   |||| ||||||| ||| ||||||||||| |   a
 ug  cg      cgccgu    uacg   cgau ucgacca uuu ccuugguuuag g   a
u  gu  -----u      ----    aaa    u       u   a           c gag 
Get sequence
Genome context
Coordinates (RGSC3.4) Overlapping transcripts
18: 2189197-2189314 [+]
sense
ENSRNOT00000018025 ; Mib1; intron 12
ENSRNOT00000018025 ; Mib1; intron 12
ENSRNOT00000018025 ; Mib1; intron 12
Clustered miRNAs
< 10kb from rno-mir-3582
rno-mir-3582 18: 2189197-2189314 [+]
rno-mir-133a 18: 2189216-2189302 [-]
rno-mir-3571 18: 2191660-2191770 [+]
rno-mir-1 18: 2191671-2191757 [-]
Database links

Mature sequence rno-miR-3582

Accession MIMAT0017872
Sequence

34 - 

cagcugguugaaggggaccaa

 - 54

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).