Stem-loop sequence rno-mir-3596a

AccessionMI0015465 (change log)
DescriptionRattus norvegicus miR-3596a stem-loop
Gene family MIPF0001194; mir-3596
Literature search

1 open access papers mention rno-mir-3596a
(1 sentences)

Stem-loop
     ug  u  --u   a -     a  -aa  c   g   c    c    aucucccuu 
5' gu  cu ug   gca g uccca gg   ag uag agg ugua aguu         g
   ||  || ||   ||| | ||||| ||   || ||| ||| |||| ||||         u
3' cg  ga ac   cgu c agggu cc   uc auc ucc acau ucaa         u
     gu  c  ugc   a g     -  gac  c   a   a    a    aucucaaug 
Get sequence
Deep sequencing
63 reads, 0 reads per million, 51 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr8: 45753254-45753367 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-3596a
rno-let-7a-2chr8: 45753264-45753359 [+]
rno-mir-3596achr8: 45753254-45753367 [-]
rno-mir-100chr8: 45746948-45747027 [+]
Database links

Mature sequence rno-miR-3596a

Accession MIMAT0017886
Sequence

67 - 

aacuauacaaccuacuaccuca

 - 88

Get sequence
Deep sequencing58 reads, 50 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).