Stem-loop sequence rno-mir-2985

AccessionMI0015469 (change log)
DescriptionRattus norvegicus miR-2985 stem-loop
Gene family MIPF0001067; mir-2985
Literature search

1 open access papers mention rno-mir-2985
(1 sentences)

Stem-loop
       -ccacac  a      ccu     a         a   g           g 
5' aucg       cu aaggau   cauua ggugggugg aua uauaacaaugu c
   ||||       || ||||||   ||||| ||||||||| ||| ||||||||||| u
3' uggc       ga uuucug   guagu ccauccacc uau auauuguugua c
       aaucuca  a      --u     c         c   g           a 
Get sequence
Deep sequencing
431 reads, 15 reads per million, 80 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr2: 179591312-179591421 [-]
sense
ENSRNOT00000067113 ; Gria2-201; intron 13
ENSRNOT00000039587 ; Gria2-202; intron 13
Database links

Mature sequence rno-miR-2985

Accession MIMAT0017891
Sequence

63 - 

uguuauaguaucccaccuaccc

 - 84

Get sequence
Deep sequencing428 reads, 80 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).