Stem-loop sequence rno-mir-122b

AccessionMI0015471 (change log)
DescriptionRattus norvegicus miR-122b stem-loop
Gene family MIPF0000095; mir-122
Stem-loop
     ag      -ag   -     u    g uu       ug    c     a      
5' gu  acggau   ccu agcag agcu u  aguguga  augg guuug uguuu 
   ||  ||||||   ||| ||||| |||| |  |||||||  |||| ||||| |||| u
3' cg  ugucug   gga ucguc ucga a  ucacacu  uacc caaac acagg 
     ga      aga   a     -    g cc       gu    a     -      
Get sequence
Deep sequencing
15 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr18: 60755272-60755380 [-]
antisense
Clustered miRNAs
< 10kb from rno-mir-122b
rno-mir-122chr18: 60755285-60755369 [+]
rno-mir-122bchr18: 60755272-60755380 [-]
Database links

Mature sequence rno-miR-122b

Accession MIMAT0017893
Sequence

63 - 

aacaccauugucacacucca

 - 82

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).