Stem-loop sequence cin-mir-4003b

AccessionMI0015529 (change log)
DescriptionCiona intestinalis miR-4003b stem-loop
Gene family MIPF0000840; mir-4003
Stem-loop
   --uga         u         gauauu 
5'      guugguuau caaucuugc      u
        ||||||||| |||||||||       
3'      caaccaaug guuagaacg      a
   aauca         -         augaca 
Get sequence
Deep sequencing
117 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
7q: 6154672-6154730 [-]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4003b
cin-mir-4077d7q: 6165860-6165915 [-]
cin-mir-4077b7q: 6155725-6155780 [-]
cin-mir-4003b7q: 6154672-6154730 [-]
cin-mir-4005b7q: 6154057-6154110 [-]
cin-mir-4077d7q: 6153229-6153284 [-]
cin-mir-4003a-17q: 6152459-6152516 [-]
cin-mir-4003c7q: 6151685-6151739 [-]
cin-mir-4077a7q: 6150979-6151034 [-]
cin-mir-4003a-47q: 6150122-6150179 [-]
cin-mir-4003d7q: 6148874-6148927 [-]
Database links

Mature sequence cin-miR-4003b-5p

Accession MIMAT0016469
Sequence

1 - 

ugaguugguuauucaaucuugcg

 - 23

Get sequence
Deep sequencing116 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4003b-3p

Accession MIMAT0016470
Sequence

38 - 

caagauugguaaccaacacuaa

 - 59

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1