Stem-loop sequence cin-mir-4003d

AccessionMI0015678 (change log)
DescriptionCiona intestinalis miR-4003d stem-loop
Stem-loop
   u a     guau   c   ug  a g 
5'  g guugg    cca ucu  ca u a
    | |||||    ||| |||  || | a
3'  c uaacc    ggu aga  gu a c
   a a     -aau   a   gu  a a 
Get sequence
Deep sequencing
20 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
7q: 6148874-6148927 [-]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4003d
cin-mir-4077d7q: 6165860-6165915 [-]
cin-mir-4077b7q: 6155725-6155780 [-]
cin-mir-4003b7q: 6154672-6154730 [-]
cin-mir-4005b7q: 6154057-6154110 [-]
cin-mir-4077d7q: 6153229-6153284 [-]
cin-mir-4003a-17q: 6152459-6152516 [-]
cin-mir-4003c7q: 6151685-6151739 [-]
cin-mir-4077a7q: 6150979-6151034 [-]
cin-mir-4003a-47q: 6150122-6150179 [-]
cin-mir-4003d7q: 6148874-6148927 [-]
Database links

Mature sequence cin-miR-4003d-3p

Accession MIMAT0016717
Sequence

35 - 

ugagaaugguaaccaauaca

 - 54

Get sequence
Deep sequencing20 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1