Stem-loop sequence hsa-mir-2355

Accession

MI0015873 (change log)

Symbol

HGNC:MIR2355

Description

Homo sapiens miR-2355 stem-loop

Gene family

MIPF0000938; mir-2355

Literature search

3 open access papers mention hsa-mir-2355
(8 sentences)

Stem-loop

   --   ac    c   c       -   u     au       uau 
5'   cag  gugu auc ccagaua caa ggaca  augcuau   a
     |||  |||| ||| ||||||| ||| |||||  |||||||   a
3'   guc  caua uag gguuugu guu ccugu  uacggua   u
   ca   gu    a   a       c   -     --       ugc 

Deep sequencing

4936 reads, 10.5 reads per million, 152 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr2: 207109987-207110073 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR2355
• HGNC:MIR2355
• RNAcentral:URS000075D52C_9606
• miRBase Tracker:MI0015873

Mature sequence hsa-miR-2355-5p

• Accession: MIMAT0016895
• Previous IDs: hsa-miR-2355
• Sequence: 11 - auccccagauacaauggacaa - 31
• Deep sequencing: 2384 reads, 140 experiments
• Evidence: experimental; SOLiD [1], Illumina [2-3,5], Northern [4]
• Database links:
  • RNAcentral:URS0000609C67_9606
• Predicted targets:
  • TargetMiner:hsa-miR-2355-5p
  • TargetScanVert:hsa-miR-2355-5p
  • miRDB:hsa-miR-2355-5p
  • microrna.org:hsa-miR-2355-5p

Mature sequence hsa-miR-2355-3p

• Accession: MIMAT0017950
• Sequence: 54 - auuguccuugcuguuuggagau - 75
• Deep sequencing: 2549 reads, 144 experiments
• Evidence: experimental; Illumina [2-3,5], Northern [4]
• Database links:
  • RNAcentral:URS00003804D8_9606
• Predicted targets:
  • TargetMiner:hsa-miR-2355-3p
  • TargetScanVert:hsa-miR-2355-3p
  • miRDB:hsa-miR-2355-3p

References

1. PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).
2. PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
3. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).
4. PMID:20532037 "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" Hansen TB, Bramsen JB, Kjems J PLoS One. 5:e10961(2010).
5. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).