![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-2355 |
|||||
Accession | MI0015873 (change log) | ||||
Symbol | HGNC:MIR2355 | ||||
Description | Homo sapiens miR-2355 stem-loop | ||||
Gene family | MIPF0000938; mir-2355 | ||||
Literature search |
3 open access papers mention hsa-mir-2355 | ||||
Stem-loop |
-- ac c c - u au uau 5' cag gugu auc ccagaua caa ggaca augcuau a ||| |||| ||| ||||||| ||| ||||| ||||||| a 3' guc caua uag gguuugu guu ccugu uacggua u ca gu a a c - -- ugc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-2355-5p |
|
Accession | MIMAT0016895 |
Previous IDs | hsa-miR-2355 |
Sequence |
11 - auccccagauacaauggacaa - 31 |
Deep sequencing | 2384 reads, 140 experiments |
Evidence | experimental; SOLiD [1], Illumina [2-3,5], Northern [4] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-2355-3p |
|
Accession | MIMAT0017950 |
Sequence |
54 - auuguccuugcuguuuggagau - 75 |
Deep sequencing | 2549 reads, 144 experiments |
Evidence | experimental; Illumina [2-3,5], Northern [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:19784364
"Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors"
PLoS One. 4:e7192(2009).
|
2 |
PMID:20224791
"Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
PLoS One. 5:e9637(2010).
|
3 | |
4 |
PMID:20532037
"Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes"
PLoS One. 5:e10961(2010).
|
5 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|