Stem-loop sequence ssc-mir-411

AccessionMI0015908 (change log)
DescriptionSus scrofa miR-411 stem-loop
Gene family MIPF0000126; mir-379
Literature search

3 open access papers mention ssc-mir-411
(5 sentences)

Stem-loop
   --cuug   a a    a      a a       - uuu 
5'       gag g uagu gaccgu u gcguacg c   a
         ||| | |||| |||||| | ||||||| |   u
3'       cuc c auca cuggca a uguaugc g   c
   cuauga   c a    c      c a       a ugu 
Get sequence
Deep sequencing
1137 reads, 114 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-411

Accession MIMAT0017954
Sequence

47 - 

auguaacacgguccacuaac

 - 66

Get sequence
Deep sequencing28 reads, 9 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).