Stem-loop sequence ssc-mir-376b

AccessionMI0015916 (change log)
DescriptionSus scrofa miR-376b stem-loop
Gene family MIPF0000091; mir-368
Literature search

3 open access papers mention ssc-mir-376b
(3 sentences)

Stem-loop
   --    u    g    cua     u         uguua 
5'   uauu aaaa gugg   uuccu cuauguuua     u
     |||| |||| ||||   ||||| |||||||||     u
3'   auga uuuu cacc   aagga gauacaaau     u
   cu    c    g    uua     -         uggug 
Get sequence
Deep sequencing
23 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-376b

Accession MIMAT0017961
Sequence

11 - 

guggcuauuccuucuauguuua

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).