Stem-loop sequence ssc-mir-4335

AccessionMI0015923 (change log)
DescriptionSus scrofa miR-4335 stem-loop
Literature search

3 open access papers mention ssc-mir-4335
(6 sentences)

Stem-loop
   ccu     ----a    --  -          cac 
5'    cuucc     gccc  ca cguugggcgc   u
      |||||     ||||  || ||||||||||   c
3'    gaagg     cggg  gu gcgacccgug   u
   --c     gauaa    ac  c          ucg 
Get sequence
Deep sequencing
270 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-4335

Accession MIMAT0017968
Sequence

35 - 

gugcccagcgcugcagggca

 - 54

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).