Stem-loop sequence ssc-mir-487b

AccessionMI0015928 (change log)
DescriptionSus scrofa miR-487b stem-loop
Gene family MIPF0000018; mir-154
Literature search

4 open access papers mention ssc-mir-487b
(4 sentences)

Stem-loop
   --    ug        uuau      c u     uuuua 
5'   uacu  gagagugg    cccugu c guucg     c
     ||||  ||||||||    |||||| | |||||      
3'   auga  uuuucacc    gggaca g uaagc     u
   cu    cu        uacu      u c     uguac 
Get sequence
Deep sequencing
31 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-487b

Accession MIMAT0017973
Sequence

11 - 

gugguuaucccuguccuguucg

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).