Stem-loop sequence ssc-mir-4338

AccessionMI0015933 (change log)
DescriptionSus scrofa miR-4338 stem-loop
Literature search

1 open access papers mention ssc-mir-4338
(1 sentences)

Stem-loop
   --      c                        cgu ug 
5'   aucucu gagauguucagucucagugggaac   g  u
     |||||| ||||||||||||||||||||||||   |  a
3'   uaggga cucuacgagucagaguuacccuug   c  a
   ac      a                        -uu ug 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrUScaf3901: 115019-115096 [-]
intergenic
Database links

Mature sequence ssc-miR-4338

Accession MIMAT0017978
Sequence

11 - 

auguucagucucagugggaacc

 - 32

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).