Stem-loop sequence ssc-mir-494

AccessionMI0015934 (change log)
DescriptionSus scrofa miR-494 stem-loop
Gene family MIPF0000018; mir-154
Literature search

3 open access papers mention ssc-mir-494
(3 sentences)

Stem-loop
   ---   ga          -g      -   c   -  uuu 
5'    cuc  aggagagguu  ucgugu ugu uuc uc   a
      |||  ||||||||||  |||||| ||| ||| ||   c
3'    gag  uuuucuccaa  ggcaca aca aag ag   u
   uau   -g          ag      u   -   u  uau 
Get sequence
Deep sequencing
123 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-494

Accession MIMAT0017979
Sequence

11 - 

agguugucguguugucuucucu

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).