Stem-loop sequence ssc-mir-4339

AccessionMI0015935 (change log)
DescriptionSus scrofa miR-4339 stem-loop
Literature search

3 open access papers mention ssc-mir-4339
(3 sentences)

Stem-loop
   --cug             agc   cc      g   -  ccc 
5'      ugcuccggcucug   ugc  cuccuc ucc gu   c
        |||||||||||||   |||  |||||| ||| ||    
3'      acgaggccgagac   gcg  gaggag agg cg   u
   cggug             --a   cc      -   u  acc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-4339

Accession MIMAT0017980
Sequence

11 - 

gcucugagcugccccuccucgucc

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).