Stem-loop sequence bta-mir-3600

AccessionMI0015943 (change log)
DescriptionBos taurus miR-3600 stem-loop
Literature search

2 open access papers mention bta-mir-3600
(2 sentences)

Stem-loop
   ca   -g   ac         ac     -      --g  gg 
5'   gag  gca  aguucuuca  uggca gcuuua   cu  g
     |||  |||  |||||||||  ||||| ||||||   ||   
3'   cuc  cgu  ucaagaagu  accgu cgaaau   gg  u
   ga   gg   ca         -c     u      aca  ac 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 23514299-23514379 [+]
antisense
ENSBTAT00000042309 ; bta-mir-22-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-3600
bta-mir-22chr19: 23514297-23514381 [-]
bta-mir-3600chr19: 23514299-23514379 [+]
Database links

Mature sequence bta-miR-3600

Accession MIMAT0016932
Sequence

10 - 

acaguucuucaacuggcagcuu

 - 31

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:19765282 "Identification and characterization of miRNAs expressed in the bovine ovary" Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D BMC Genomics. 10:443(2009).