Stem-loop sequence bta-mir-3578

AccessionMI0015945 (change log)
DescriptionBos taurus miR-3578 stem-loop
Gene family MIPF0001166; mir-3578
Stem-loop
   uu       -   aaaagu     c    aau       caua 
5'   ugguacu gaa      guugu cgug   gauucgu    a
     ||||||| |||      ||||| ||||   |||||||     
3'   accauga cuu      caaca gcac   cuaagcg    g
   ac       a   -cucuu     a    cac       aaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67871246-67871331 [-]
antisense
ENSBTAT00000042170 ; bta-mir-3578-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-3578
bta-mir-3957chr21: 67881103-67881179 [+]
bta-mir-541chr21: 67880717-67880800 [+]
bta-mir-377chr21: 67878863-67878931 [+]
bta-mir-496chr21: 67877242-67877342 [+]
bta-mir-154bchr21: 67876730-67876810 [+]
bta-mir-154achr21: 67876412-67876495 [+]
bta-mir-453chr21: 67873059-67873138 [+]
bta-mir-485chr21: 67872328-67872400 [+]
bta-mir-668chr21: 67872162-67872257 [+]
bta-mir-134chr21: 67871630-67871702 [+]
bta-mir-382chr21: 67871251-67871326 [+]
bta-mir-3578chr21: 67871246-67871331 [-]
bta-mir-487achr21: 67868237-67868316 [+]
bta-mir-411cchr21: 67867851-67867924 [+]
bta-mir-655chr21: 67865688-67865784 [+]
bta-mir-544achr21: 67864731-67864821 [+]
bta-mir-539chr21: 67862745-67862822 [+]
bta-mir-487bchr21: 67861931-67862014 [+]
bta-mir-381chr21: 67861446-67861520 [+]
Database links

Mature sequence bta-miR-3578

Accession MIMAT0016934
Sequence

51 - 

gaauccaccacgaacaacuuc

 - 71

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:19765282 "Identification and characterization of miRNAs expressed in the bovine ovary" Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D BMC Genomics. 10:443(2009).