Stem-loop sequence bta-mir-3596

Accession MI0015952
Description Bos taurus miR-3596 stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
cucga ga   c          auaguuaucuuccgaggggg 
     g  agg aguagguugu                    c
     |  ||| ||||||||||                    a
     c  ucc ucauccaaca                    a
----c ac   a          caccaaagucccaucacuac 
Get sequence
Genome context
Coordinates (UMD3.1) Overlapping transcripts
chr5: 117120188-117120270 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-3596
bta-mir-3596 chr5: 117120188-117120270 [-]
bta-let-7b chr5: 117120185-117120265 [+]
bta-mir-2443 chr5: 117119640-117119712 [+]
bta-let-7a-3 chr5: 117119385-117119458 [+]
Database links

Mature sequence bta-miR-3596

Accession MIMAT0016940
Sequence

60 - 

aaccacacaaccuacuaccuca

 - 81

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:19765282 "Identification and characterization of miRNAs expressed in the bovine ovary" Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D BMC Genomics. 10:443(2009).