Stem-loop sequence ame-mir-1-2

AccessionMI0015955 (change log)
DescriptionApis mellifera miR-1-2 stem-loop
Gene family MIPF0000038; mir-1
Literature search

5 open access papers mention ame-mir-1-2
(15 sentences)

Stem-loop
          augcu            c    uuc     -  g   
5' ccgggcg     guuccgugcuuc uuac   ccaua gu ga 
   |||||||     |||||||||||| ||||   ||||| || | u
3' ggcccgc     cgagguaugaag aaug   gguau ca cg 
          ---gu            a    uaa     g  g   
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000069.5: 5129826-5129908 [+]
intergenic
Database links

Mature sequence ame-miR-1-3p

Accession MIMAT0001471
Sequence

52 - 

uggaauguaaagaaguauggag

 - 73

Get sequence
Evidence experimental; array [1], RTPCR [1], Illumina [2]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).