Stem-loop sequence bfl-mir-135b-2

Accession

MI0015994

Description

Branchiostoma floridae miR-135b-2 stem-loop

Gene family

MIPF0000028; mir-135

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-135_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

Stem-loop

ccg            uu    cuu      -   cu 
   uguccaauggcu  cauc   ugugaa ugu  g
   ||||||||||||  ||||   |||||| |||   
   acagguuauugg  guag   acacuu aca  a
aga            gg    -uc      g   cg 

Deep sequencing

14 reads, 1 experiments

Genome context

• Coordinates (JGI2.0): Bf_V2_158: 3848991-3849062 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from bfl-mir-135b-2

• bfl-mir-135b-2: Bf_V2_158: 3848991-3849062 [-]
• bfl-mir-135a-2: Bf_V2_158: 3848762-3848843 [-]
• bfl-mir-135b-1: Bf_V2_158: 3847619-3847690 [-]
• bfl-mir-135a-1: Bf_V2_158: 3847395-3847476 [-]

Mature sequence bfl-miR-135b

• Accession: MIMAT0010194
• Sequence: 9 - aauggcuuucauccuuuguga - 29
• Deep sequencing: 28 reads, 1 experiments
• Evidence: experimental; 454 [1]

References

1. PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).