Stem-loop sequence hsa-mir-3615

Accession MI0016005
Description Homo sapiens miR-3615 stem-loop
Gene family MIPF0001540; mir-3615
Stem-loop 
    c g  a    ca  c      c     g    uu  u u 
gacu u gg cgcu  ga gccgcg ggggc ggga  gg c g
|||| | || ||||  || |||||| ||||| ||||  || |  
uugg a cc gcgg  cu cggcgc ccucg cucu  cc g u
    c g  g    cg  -      u     g    cu  u g
Get sequence
Deep sequencing
91 reads, 22 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 72744752-72744838 [+]
sense
OTTHUMT00000443670 ; SLC9A3R1-006; 3'UTR (exon 1)
OTTHUMT00000443671 ; SLC9A3R1-001; 3'UTR (exon 1)
ENST00000262613 ; SLC9A3R1-201; 3'UTR (exon 1)
ENST00000262613 ; SLC9A3R1-201; 3'UTR (exon 1)
ENST00000583369 ; SLC9A3R1-006; 3'UTR (exon 1)
ENST00000262613 ; SLC9A3R1-001; 3'UTR (exon 1)
antisense
OTTHUMT00000443669 ; RP11-452I5.2-001; exon 1
ENST00000585285 ; MIR3615-001; exon 1
Database links

Mature sequence hsa-miR-3615

Accession MIMAT0017994
Sequence

51 -  

ucucucggcuccucgcggcuc

 - 71

Get sequence
Deep sequencing 71 reads, 11 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).