Stem-loop sequence vvi-MIR3623

AccessionMI0016015 (change log)
DescriptionVitis vinifera miR3623 stem-loop
Literature search

1 open access papers mention vvi-MIR3623
(3 sentences)

Stem-loop
           u    a    ca       a             uaaagcucaaac      ac      c 
5' aagaauuu gaug ucuu  caaguuc uccaagcaccauc            aggccu  gguuuu u
   |||||||| |||| ||||  ||||||| |||||||||||||            ||||||  ||||||  
3' uucuugaa uuac agaa  guuuaag agguucgugguag            uucgga  ucaaaa u
           -    a    uc       c             ------uacuua      --      c 
Get sequence
Deep sequencing
31869 reads, 2.1e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr18: 24650012-24650140 [+]
intergenic
Database links

Mature sequence vvi-miR3623-5p

Accession MIMAT0018007
Previous IDsvvi-miR3623*
Sequence

18 - 

ucacaaguucauccaagcacca

 - 39

Get sequence
Deep sequencing17784 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence vvi-miR3623-3p

Accession MIMAT0018008
Previous IDsvvi-miR3623
Sequence

92 - 

uggugcuuggacgaauuugcua

 - 113

Get sequence
Deep sequencing14083 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20230504 "Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis" Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, Burgyan J Plant J. 62:960-976(2010).