Stem-loop sequence vvi-MIR3630

AccessionMI0016026 (change log)
DescriptionVitis vinifera miR3630 stem-loop
Gene family MIPF0001542; MIR3630
Literature search

2 open access papers mention vvi-MIR3630
(3 sentences)

Stem-loop
          g       --  u  c   a  aga        --   g  -c      
5' caguaug uugugca  ag ga gau uc   cagggaca  uca ca  cucca 
   ||||||| |||||||  || || ||| ||   ||||||||  ||| ||  |||| a
3' guuauac aacacgu  uc cu cua ag   guuucugu  agu gu  gaggu 
          g       ag  u  -   -  --g        uu   a  aa      
Get sequence
Deep sequencing
141 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr17: 6897444-6897545 [+]
intergenic
Database links

Mature sequence vvi-miR3630-5p

Accession MIMAT0018027
Previous IDsvvi-miR3630
Sequence

12 - 

ugcaagugacgauaucagaca

 - 32

Get sequence
Deep sequencing127 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence vvi-miR3630-3p

Accession MIMAT0018028
Previous IDsvvi-miR3630*
Sequence

71 - 

uuugggaaucucucugaugcac

 - 92

Get sequence
Deep sequencing13 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20230504 "Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis" Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, Burgyan J Plant J. 62:960-976(2010).