Stem-loop sequence dme-mir-3644

AccessionMI0016044 (change log)
DescriptionDrosophila melanogaster miR-3644 stem-loop
Literature search

1 open access papers mention dme-mir-3644
(1 sentences)

Stem-loop
   ---------   ag   u         a     a 
5'          gug  uga uaugguuua guaau c
            |||  ||| ||||||||| |||||  
3'          cac  auu auaucaaau cauua g
   gauucuuau   ca   u         a     a 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 15192297-15192357 [-]
sense
FBtr0083029 ; CG6752-RA; intron 9
FBtr0306246 ; CG6752-RB; intron 9
Database links

Mature sequence dme-miR-3644-5p

Accession MIMAT0018061
Previous IDsdme-miR-3644
Sequence

1 - 

gugagugauuaugguuuaagua

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dme-miR-3644-3p

Accession MIMAT0018062
Previous IDsdme-miR-3644*
Sequence

33 - 

cauaaacuauauuuaaccacuau

 - 55

Get sequence
Deep sequencing9 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20620959 "MicroRNA biogenesis via splicing and exosome-mediated trimming in Drosophila" Flynt AS, Greimann JC, Chung WJ, Lima CD, Lai EC Mol Cell. 38:900-907(2010).