Stem-loop sequence hsa-mir-3663

AccessionMI0016064 (change log)
Symbol HGNC:MIR3663
DescriptionHomo sapiens miR-3663 stem-loop
Literature search

4 open access papers mention hsa-mir-3663
(6 sentences)

Stem-loop 
   ---   ggga         a      -      c             -   u 
5'    ccc    ccuuggucc ggcgcu ggucug guggugcucgggu gga a
      |||    ||||||||| |||||| |||||| ||||||||||||| |||  
3'    ggg    ggaaccagg ccgcgg ccggac caccacgagucua ucu a
   cuc   ----         g      g      a             g   g
Get sequence
Deep sequencing
185 reads, 38.5 reads per million, 52 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 117167678-117167774 [-]
antisense
OTTHUMT00000384501 ; ATRNL1-011; intron 3
OTTHUMT00000384500 ; ATRNL1-010; intron 4
OTTHUMT00000050507 ; ATRNL1-001; intron 20
ENST00000534530 ; ATRNL1-011; intron 3
ENST00000303745 ; ATRNL1-201; intron 3
ENST00000526373 ; ATRNL1-010; intron 4
ENST00000423111 ; ATRNL1-202; intron 4
ENST00000355044 ; ATRNL1-001; intron 20
Database links

Mature sequence hsa-miR-3663-5p

Accession MIMAT0018084
Sequence

21 -  

gcuggucugcguggugcucgg

 - 41

Get sequence
Deep sequencing34 reads, 13 experiments
Evidence experimental; Northern [1]
Predicted targets

Mature sequence hsa-miR-3663-3p

Accession MIMAT0018085
Sequence

58 -  

ugagcaccacacaggccgggcgc

 - 80

Get sequence
Deep sequencing70 reads, 23 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:20532037 "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" Hansen TB, Bramsen JB, Kjems J PLoS One. 5:e10961(2010).
2
PMID:20498841 "Deep sequencing of human nuclear and cytoplasmic small RNAs reveals an unexpectedly complex subcellular distribution of miRNAs and tRNA 3' trailers" Liao JY, Ma LM, Guo YH, Zhang YC, Zhou H, Shao P, Chen YQ, Qu LH PLoS One. 5:e10563(2010).