![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3664 |
|||||
Accession | MI0016065 (change log) | ||||
Symbol | HGNC:MIR3664 | ||||
Description | Homo sapiens miR-3664 stem-loop | ||||
Gene family | MIPF0001518; mir-3664 | ||||
Stem-loop |
cuguaa - c a uac cc 5' ac uugaagguagggaacucugucuu acuc ugag cuu a || ||||||||||||||||||||||| |||| |||| ||| a 3' ug aacuuccaucccuugagacagaa ugag acuc gag c --uagg u a g -uc ca |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-3664-5p |
|
Accession | MIMAT0018086 |
Previous IDs | hsa-miR-3664 |
Sequence |
21 - aacucugucuucacucaugagu - 42 |
Deep sequencing | 108 reads, 40 experiments |
Evidence | experimental; Northern [1], Illumina [2] |
Predicted targets |
|
Mature sequence hsa-miR-3664-3p |
|
Accession | MIMAT0019220 |
Sequence |
59 - ucucaggaguaaagacagaguu - 80 |
Deep sequencing | 895 reads, 102 experiments |
Evidence | experimental; Illumina [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20532037
"Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes"
PLoS One. 5:e10961(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|