![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3677 |
||||||||
Accession | MI0016078 (change log) | |||||||
Symbol | HGNC:MIR3677 | |||||||
Description | Homo sapiens miR-3677 stem-loop | |||||||
Literature search |
3 open access papers mention hsa-mir-3677 | |||||||
Stem-loop |
a ------u -a 5' ggc guggccagagccc gc gugcu ||| ||||||||||||| || |||| g 3' ccg caccggucucggg cg uacgg g ugcucuu gg |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence hsa-miR-3677-5p |
|
Accession | MIMAT0019221 |
Sequence |
3 - caguggccagagcccugcagug - 24 |
Deep sequencing | 160 reads, 49 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
Mature sequence hsa-miR-3677-3p |
|
Accession | MIMAT0018101 |
Previous IDs | hsa-miR-3677 |
Sequence |
39 - cucgugggcucuggccacggcc - 60 |
Deep sequencing | 271 reads, 53 experiments |
Evidence | experimental; Illumina [1-2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20459673
"Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood"
BMC Genomics. 11:288(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|