![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3688-1 |
||||||
Accession | MI0016089 (change log) | |||||
Previous IDs | hsa-mir-3688 | |||||
Symbol | HGNC:MIR3688-1 | |||||
Description | Homo sapiens miR-3688-1 stem-loop | |||||
Gene family | MIPF0001263; mir-3688 | |||||
Stem-loop |
c au ugua 5' ucuucacuuu aagaguggcaaagucuuuccauaugu gua u |||||||||| |||||||||||||||||||||||||| ||| g 3' agaagugaaa uucucaccguuucagaaagguauaca cau u u -- uguc |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-3688-5p |
|
Accession | MIMAT0019223 |
Sequence |
15 - aguggcaaagucuuuccauau - 35 |
Deep sequencing | 46 reads, 7 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
Mature sequence hsa-miR-3688-3p |
|
Accession | MIMAT0018116 |
Previous IDs | hsa-miR-3688 |
Sequence |
60 - uauggaaagacuuugccacucu - 81 |
Deep sequencing | 443 reads, 80 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20459673
"Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood"
BMC Genomics. 11:288(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|