Stem-loop sequence ame-mir-2788

AccessionMI0016140 (change log)
DescriptionApis mellifera miR-2788 stem-loop
Gene family MIPF0001204; mir-2788
Stem-loop
   ag     a uu     c    ggg          uau c     g   ----   g 
5'   guugg g  cguug ggca   uugggguuuc   g ggcau ugc    cuu c
     ||||| |  ||||| ||||   ||||||||||   | ||||| |||    ||| u
3'   caacu u  gcaac cugu   aacccuaaag   c ccgua acg    gag u
   -a     a uc     -    aaa          cuu -     -   uaaa   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000054.5: 211099-211205 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-2788
ame-mir-193CM000054.5: 204902-205020 [+]
ame-mir-2788CM000054.5: 211099-211205 [+]
Database links

Mature sequence ame-miR-2788-3p

Accession MIMAT0018510
Sequence

65 - 

caaugcccuucgaaaucccaaa

 - 86

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).