Stem-loop sequence ame-mir-3791

AccessionMI0016200 (change log)
DescriptionApis mellifera miR-3791 stem-loop
Stem-loop
   aau      a u c   c       a   cg       u    ggaa 
5'    auagag c g ugu ggaugaa ucu  uccggug gguu    a
      |||||| | | ||| ||||||| |||  ||||||| ||||     
3'    ugucuc g c gua ccuacuu agg  gggccac ccaa    a
   --u      c c u   a       -   au       u    aaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000066.5: 1395544-1395636 [-]
intergenic
Clustered miRNAs
< 10kb from ame-mir-3791
ame-mir-3478CM000066.5: 1395549-1395626 [+]
ame-mir-3791CM000066.5: 1395544-1395636 [-]
ame-mir-279bCM000066.5: 1395401-1395527 [-]
ame-mir-9cCM000066.5: 1395236-1395374 [-]
ame-mir-2944CM000066.5: 1395048-1395172 [-]
ame-mir-318CM000066.5: 1394890-1395007 [-]
Database links

Mature sequence ame-miR-3791-3p

Accession MIMAT0018570
Sequence

58 - 

ucaccggguaggauucaucca

 - 78

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).