Stem-loop sequence ame-mir-279b

AccessionMI0016201 (change log)
DescriptionApis mellifera miR-279b stem-loop
Literature search

3 open access papers mention ame-mir-279b
(5 sentences)

Stem-loop
   aaa    u    aau  u  a     gu            a     - -       gca   uugua 
5'    uguu guga   uu au cucuu  uauuagggacga guauu c aucuagu   acg     a
      |||| ||||   || || |||||  |||||||||||| ||||| | |||||||   |||      
3'    acaa uacu   aa ua gagag  auaaucccugcu cauaa g uagauca   ugc     a
   --a    c    aau  c  a     --            -     a c       --g   uaaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000066.5: 1395401-1395527 [-]
intergenic
Clustered miRNAs
< 10kb from ame-mir-279b
ame-mir-3478CM000066.5: 1395549-1395626 [+]
ame-mir-3791CM000066.5: 1395544-1395636 [-]
ame-mir-279bCM000066.5: 1395401-1395527 [-]
ame-mir-9cCM000066.5: 1395236-1395374 [-]
ame-mir-2944CM000066.5: 1395048-1395172 [-]
ame-mir-318CM000066.5: 1394890-1395007 [-]
Database links

Mature sequence ame-miR-279b-3p

Accession MIMAT0018571
Sequence

75 - 

ugacuagaucgaaauacucguccc

 - 98

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).