Stem-loop sequence ame-mir-9c

Accession MI0016202
Description Apis mellifera miR-9c stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
gcu      --        -uaccaaauc   c  uu      u     g       a  g      gaau 
   guuuca  cacauuuc          guc cg  uauuuu cuuug ugagcua cu uauggu    u
   ||||||  ||||||||          ||| ||  |||||| ||||| ||||||| || ||||||     
   uaaagu  guguaaag          cag gc  auagaa ggaac acuugau ga auaccg    g
--u      ca        uacuucgaua   a  uu      c     g       c  a      gaaa 
Get sequence
Deep sequencing
2950 reads, 1 experiments
Genome context
Coordinates (Amel_4.0) Overlapping transcripts
Group15.13: 55084-55222 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-9c
ame-mir-3791 Group15.13: 54822-54914 [+]
ame-mir-279b Group15.13: 54931-55057 [+]
ame-mir-9c Group15.13: 55084-55222 [+]
ame-mir-2944 Group15.13: 55286-55410 [+]
ame-mir-318 Group15.13: 55451-55568 [+]
Database links

Mature sequence ame-miR-9c

Accession MIMAT0018572
Sequence

79 - 

uaaagcuaguucagcaaggca

 - 99

Get sequence
Deep sequencing 2597 reads, 1 experiments
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).