Stem-loop sequence ame-mir-2944

AccessionMI0016203 (change log)
DescriptionApis mellifera miR-2944 stem-loop
Gene family MIPF0001335; mir-2944
Literature search

2 open access papers mention ame-mir-2944
(3 sentences)

Stem-loop
   a    -------------    aauuu  a         -    a g    c             uug cg 
5'  cucc             agaa     ag ugaaagaau ucgg g aacu uugcugugauaug   c  u
    ||||             ||||     || ||||||||| |||| | |||| |||||||||||||   |  a
3'  gagg             ucuu     uc gcuuucuua gguc c uuga gacgacacuauac   g  a
   c    aaccauuuccacu    -----  c         u    - a    u             uua aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000066.5: 1395048-1395172 [-]
intergenic
Clustered miRNAs
< 10kb from ame-mir-2944
ame-mir-3478CM000066.5: 1395549-1395626 [+]
ame-mir-3791CM000066.5: 1395544-1395636 [-]
ame-mir-279bCM000066.5: 1395401-1395527 [-]
ame-mir-9cCM000066.5: 1395236-1395374 [-]
ame-mir-2944CM000066.5: 1395048-1395172 [-]
ame-mir-318CM000066.5: 1394890-1395007 [-]
Database links

Mature sequence ame-miR-2944-3p

Accession MIMAT0018573
Sequence

69 - 

uaucacagcaguaguuaccuggu

 - 91

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).