Stem-loop sequence ame-mir-318

AccessionMI0016204 (change log)
DescriptionApis mellifera miR-318 stem-loop
Stem-loop
   ac   ---c   au    -ua     a  --      ug          uguu       aau 
5'   gca    uga  auua   aguac uc  auggga  aacgugaucc    ugacggu   a
     |||    |||  ||||   ||||| ||  ||||||  ||||||||||    |||||||    
3'   cgu    gcu  uaau   ucaug ag  uacccu  uuguauuggg    acugcua   a
   -a   uauc   ac    uag     -  ca      gu          --uc       guu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000066.5: 1394890-1395007 [-]
intergenic
Clustered miRNAs
< 10kb from ame-mir-318
ame-mir-3478CM000066.5: 1395549-1395626 [+]
ame-mir-3791CM000066.5: 1395544-1395636 [-]
ame-mir-279bCM000066.5: 1395401-1395527 [-]
ame-mir-9cCM000066.5: 1395236-1395374 [-]
ame-mir-2944CM000066.5: 1395048-1395172 [-]
ame-mir-318CM000066.5: 1394890-1395007 [-]
Database links

Mature sequence ame-miR-318-3p

Accession MIMAT0018574
Sequence

67 - 

ucacuggguuauguuuguccc

 - 87

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).