Stem-loop sequence ame-mir-279c

AccessionMI0016216 (change log)
DescriptionApis mellifera miR-279c stem-loop
Literature search

3 open access papers mention ame-mir-279c
(5 sentences)

Stem-loop
   aua        u  u          -c       ua     u ga 
5'    uauucuaa cg uggacgggug  acucugg  ucaug g  u
      |||||||| || ||||||||||  |||||||  ||||| |   
3'    auaagguu gu accugcucac  ugagauc  aguac c  u
   --c        c  u          ac       --     u gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000055.5: 10170336-10170422 [+]
intergenic
Database links

Mature sequence ame-miR-279c-3p

Accession MIMAT0018586
Sequence

53 - 

ugacuagagucacacucgucca

 - 74

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).