Stem-loop sequence tgu-mir-132

AccessionMI0016249 (change log)
DescriptionTaeniopygia guttata miR-132 stem-loop
Gene family MIPF0000065; mir-132
Literature search

1 open access papers mention tgu-mir-132
(1 sentences)

Stem-loop
   auccgac   --g     g           u     a      g      
5'        gcc   cccgg cgaccguggcu uagau guuacu uucca 
          |||   ||||| ||||||||||| ||||| |||||| |||| c
3'        cgg   gggcc gcugguaccga aucug caauga ggggu 
   gcucaga   aca     -           c     a      g      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tgu-miR-132

Accession MIMAT0018619
Sequence

57 - 

uaacagucuacagccauggucg

 - 78

Get sequence
Evidence not experimental

References

1
PMID:21627805 "Song exposure regulates known and novel microRNAs in the zebra finch auditory forebrain" Gunaratne PH, Lin YC, Benham AL, Drnevich J, Coarfa C, Tennakoon JB, Creighton CJ, Kim JH, Milosavljevic A, Watson M, Griffiths-Jones S, Clayton DF BMC Genomics. 12:277(2011).