Stem-loop sequence hsa-mir-3911

AccessionMI0016415 (change log)
Symbol HGNC:MIR3911
DescriptionHomo sapiens miR-3911 stem-loop
Literature search

2 open access papers mention hsa-mir-3911
(2 sentences)

Stem-loop 
        a    g  u u     cug      -    ag   ac    -agcuu    g 
5' gggug ggau ug g ggauc   gaggag gcag  aag  agug      gcca u
   ||||| |||| || | |||||   |||||| ||||  |||  ||||      ||||  
3' cccac ucua ac c cuuag   cucuuc cguc  uuc  ucac      uggu u
        g    g  - -     ---      g    cu   cu    aaccuu    c
Get sequence
Deep sequencing
230 reads, 1.69 reads per million, 59 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 127690687-127690795 [-]
sense
OTTHUMT00000054051 ; GOLGA1-003; intron 1
OTTHUMT00000054053 ; GOLGA1-005; intron 4
OTTHUMT00000054049 ; GOLGA1-001; intron 5
ENST00000475407 ; GOLGA1-003; intron 1
ENST00000421514 ; GOLGA1-005; intron 4
ENST00000373555 ; GOLGA1-001; intron 5
Database links

Mature sequence hsa-miR-3911

Accession MIMAT0018185
Sequence

12 -  

uguguggauccuggaggaggca

 - 33

Get sequence
Deep sequencing208 reads, 49 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).