![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3911 |
|||||
Accession | MI0016415 (change log) | ||||
Symbol | HGNC:MIR3911 | ||||
Description | Homo sapiens miR-3911 stem-loop | ||||
Literature search |
2 open access papers mention hsa-mir-3911 | ||||
Stem-loop |
a g u u cug - ag ac -agcuu g 5' gggug ggau ug g ggauc gaggag gcag aag agug gcca u ||||| |||| || | ||||| |||||| |||| ||| |||| |||| 3' cccac ucua ac c cuuag cucuuc cguc uuc ucac uggu u g g - - --- g cu cu aaccuu c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-3911 |
|
Accession | MIMAT0018185 |
Sequence |
12 - uguguggauccuggaggaggca - 33 |
Deep sequencing | 208 reads, 49 experiments |
Evidence | experimental; Illumina [1-2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20224791
"Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
PLoS One. 5:e9637(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|