![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3914-2 |
||||||
Accession | MI0016421 (change log) | |||||
Symbol | HGNC:MIR3914-2 | |||||
Description | Homo sapiens miR-3914-2 stem-loop | |||||
Gene family | MIPF0001169; mir-3914 | |||||
Literature search |
1 open access papers mention hsa-mir-3914-2 | |||||
Stem-loop |
g cuacuc cca ua
5' ga uuc aacuucucauuuucugguuccuucua agu a
|| ||| |||||||||||||||||||||||||| ||| g
3' cu aag uugaagaguaaaagaccaaggaagau uca c
g ucuaaa uac ua
|
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence hsa-miR-3914 |
|
Accession | MIMAT0018188 |
Sequence |
61 - aaggaaccagaaaaugagaagu - 82 |
Deep sequencing | 65 reads, 27 experiments |
Evidence | experimental; Illumina [1-2] |
Predicted targets |
|
References |
|
1 |
PMID:20224791
"Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
PLoS One. 5:e9637(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|